Roche lightcycler ebv assay as well as buffer roche lightcycler faststart dna master hybprobe, vial 1b was added to the pcr products and the melting curve analysis was performed using programs 1, 3, and 4 95c for 10 min, 40c for 60 s, and 40c. Nthe amplicon size should not exceed 1 kb in length. Lightcycler faststart dna master hybprobe, 300 nm of each primer, 200 nm of each probe and 2 m mgcl 2. Original article a novel molecular assay using hybridisation.
Lightcycler dna master hybprobe roche applied science. One probe had been labeled at the 50 end with the lightcycler red 640. Lightcycler faststart dna master hybprobe from roche. Lightcycler faststart dna master hybprobe from roche description easytouse hot start reaction mix for pcr using the lightcycler carouselbased system. Molecular weight marker vii amplification of cdna the ability of faststart pcr master to amplify cdna is demonstrated. Twostep rtpcr lightcycler 480 sybr green i master can also be used to perform twostep rtpcr. Samples were amplified and detected on the lightcycler 1. The outer primers bvd 180 and hcv 368 amplified a 2 base pair pcr product from 5 ml of rna sample. Easytouse hot start reaction mix for pcr using the lightcycler carouselbased system. For optimal results, select a product length of less than 700 bp. Easytouse hot start reaction mix for pcr, using hybprobe probes with the lightcycler carouselbased system.
Roche applied science lightcycler 480 realtime pcr system. Amplifications reactions were carried out in a total volumes of 20. Lightcycler faststart dna master hybprobe roche life science. We are continuing to break new ground by offering a choice in instruments designed to meet your research needs. The faststart dna master hybprobe is not included in vkorc1 kits supplied through roche diagnostics or its local distributor. Roche lightcycler ebv assay to the purified pcr dna in the presence of reaction buffer roche lightcycler faststart dna master hybprobe, vial 1b. Realtime pcr assays were performed on the lightcycler 480 instrument ii. Molecular diagnostics reagents and products list nys net. Easytouse hot start mix for sensitive pcr in lightcycler capillaries on lightcycler. Rapid detection of dirofilaria immitis in mosquito vectors. Lightcycler faststart dna master hybprobe 1 kit for 480 reactions of 20 ul final reaction volume catalog no.
The lightcycler faststart dna master sybr green i provides convenience, high performance, reproducibility, and minimizes contamination risk. Roche diagnostics lightcycler faststart dna mast lightcycler. Easytouse hot start reaction mix for pcr using hybprobe probes with the lightcycler carouselbased system. For each assay the following components were added to a total of 20 lreaction capillary. Sep 30, 2010 amplification was performed in a final volume of 20. D after purification of pcr products, the fluorescent probe primerhybridization probes. Research article open access neisseria gonorrhoeae and. Lightcycler faststart dna master sybr green i is an easytouse hot start reaction mix for sensitive pcr applications in lightcycler capillaries, using sybr green i as detection format. Lightcycler faststart dna master hybprobe store at 20c upon arrival faststart dna master hybprobe is included in kits supplied directly by tib molbiol for customers in central europe only 1. Besides quantification of template the hybprobe format also allows the detection of.
It is an ideal master mix for performing quantitative pcr, as well as snp and mutation detection and can also be used in twostep rtpcr. Depending on the acceptor dye used for labeling the hybprobe probe, choose channel 610, 640, 670, or 705. Contents vial cap label function catalog number content 1a red lightcycler faststart dna master hybprobe, lc faststart enzyme readytouse hot start reaction mix after pipetting 60. The authors 2011 polymorphism in neonatal respiratory. Faststart pcr master, 365 bp from 1 ng human genomic dna lane 4. The addition of mgcl 2 provided in the kit for specific applications may be necessary. The lightcycler faststart dna master hybprobe kit roche was used for pcr reactions in accordance with the manufacturers instructions. Protect the lightcycler faststart reaction mix sybr green i. Use with lightcycler dna m aster hybprobe roche cat. For hot start pcr, we recommend using lightcycler faststart dna master hybprobe, or lightcycler faststart dna masterplus hybprobe, which contain a chemically modified taq dna polymerase, that is activated by heat. Lightcycler faststart dna master hybprobe is an easytouse hot start reaction mix for sensitive pcr applications in lightcycler capillaries, using hybprobe probes as detection format. For in vitro lightcycler faststart dna master sybr green i.
Pcr, using the intercalating sybr green i dye for dna detection and. Mutation analysis of the shoc2 gene in noonanlike syndrome. Lightcycler faststart dna master hybprobe y version. Roche diagnostics lightcycler faststart dn lightcycler. Master mix has been designed to match or exceed the performance of standard master mixes, delivering shorter run times lightcycler dna master hybprobe roche cat. Faststart taqman probe master is a readytouse hot start reaction mix without rox for quantitative polymerase chain reaction qpcr and reverse transcription rtqpcr on realtime pcr systems other than the lightcycle instruments. The protocol used in this study was as described by lightcycler scrapie susceptibility mutation detection kit tib molbiol, berlin, germany, used with roche faststart reagents lightcycler faststart dna master plus hybprobe roche, mannheim. For the second round, a lightcycler faststart dna master hybprobe kitb was used.
Lightcycler 96 realtime pcr system super capabilities are. The described performance of the kit can be guaranteed for use on the lightcycler. In both assays albumin was coamplified as an internal reference gene. The kit can be used to perform quantitative pcr, as well as snp and mutation detection.
Rapid detection and molecular differentiation of toxigenic. Updates nys october 2010 material number description material. Preincubation for activation of faststart taq dna polymerase and denaturation of the dna amplification of the target dna. For the qpcr itself, i am using the roche lightcycler nano, i use the roche probes master mix, along with probes from the universal probes library which are now made by merck. Lightcycler 480 genotyping software performs genotyping analysis on hybprobe or simpleprobe based experiments containing a melting curve program subsequent to pcr. Master mix has been designed to match or exceed the performance of standard master mixes, delivering shorter run times m aster hybprobe roche cat. Lightcycler 480 sybr green i master lightcycler 480 probes master lightcycler 480 genotyping master, specially designed for hybprobe probe or simpleprobe probe assays, and optimized for melting curve performance. Lightcycler dna master hybprobe, lightcycler faststart dna master hybprobe, or lightcycler faststart dna masterplus hybprobe. Lightcycler faststart dna master sybr green i readytouse hot start reaction mix for pcr using the lightcycler1 instrument cat. A lightcycler taqman assay for detection of borrelia.
Twostep rtpcr lightcycler dna master hybprobe can also be used to perform twostep rtpcr. Lightcycler 96 dna green value pack l 06 7 106 001 20 packs faststart essential dna green master 100 ml. Lightcycler dna master hybprobe is an easytouse reaction mix for sensitive pcr applications in lightcycler capillaries, using hybprobe probes as detection format. Sample dna was extracted using abbott sp2000 as recommended by the manufacturer, and 5. The hot start feature of the master mix is provided by faststart taq dna polymerase, a chemically modified taq dna polymerase, which is inactive at room temperature and becomes activated at high temperatures i. Use with lightcycler faststart dna master sybr green i roche cat. Taqman realtime pcr quantification strategy of cyp2d6 gene. A chlamydia trachomatis strain with a 377bp deletion in. Lightmix universal color compensation hybprobe version 1018 20 tib molbiol page 2 of 12 2. L since your target dna template contains thymidine rather than uridine, it is not affected by this procedure. The lightcycler 480 system unleash the potential of realtime pcr. L the use of ung might lower the melting temperature t m in melting curve analysis. Unfortunately, we could not detect pai1 antigen or activity because of the limited.
Lightcycler faststart dna master hybprobe is an easytouse hot start reaction mix for sensitive pcr applications in lightcycler capillaries, using hybprobe. Lightcycler faststart dna master hybprobe 1 kit for 96 reactions of 20 ul final reaction volume catalog no. L of lightcycler faststart dna master hybprobe mix faststart taq dna polymerase, reaction buffer, dntp mix with dutp instead of dttp, and 10 mmoll mgcl 2 roche, 0. A negative control no template dna in the reaction was included in each pcr run. Taqman fast advanced master mix on the roche lightcycler. Use of the roche lightcycler instrument in a realtime pcr. The platebased lightcycler 480 system is a highly adaptable and versatile realtime pcr system for the analysis of gene expression and genetic variation. L reaction volume in a glass capillary contained 5. To confirm this sequence variation, a t m analysis was performed by adding fluorescent probes primerhybridization probes. Nov 21, 2019 for the qpcr itself, i am using the roche lightcycler nano, i use the roche probes master mix, along with probes from the universal probes library which are now made by merck.
The faststart sybr green master is a readytouse, 2. The unique lightcycler hybprobe format is based on the principle of fluorescence resonance energy transfer fret. Use with lightcycler faststart dna master hybprobe roche cat. They are the ideal master mixes for performing quantitative pcr, as well as snp and mutation detection. Custom synthesis hybprobe 640 set 5lc 3fl 1 nmol 17264003 custom synthesis hybprobe 640 set 5lc 3fl 3 nmol 17264006 custom synthesis hybprobe 640 set 5lc 3fl 2 x 3 nmol 17264030 custom synthesis hybprobe 640 set 5lc 3fl 30 nmol. The scrapie genetic susceptibility of some sheep breeds in. The pcr process is monitored by fluorescence quantification of dnabinding dyes for general detection of double stranded dna, or, with hybridization probes, to monitor the amount of a specific target sequence. Lightcyclerfaststart dna master hybprobe roche diagnostics, 12 n m.
The pcr primers for this reaction were bvdvl1 tgccatgtacagcagagattt and bvdvu3 catgcccaaagcacatctta. As the reverse transcription step is omitted, any pcr product generated is a signal for dna contamination of the rna template preparation. Sensitivity of polymerase chain reaction for detection of. L of extracted dna from each isolate was used as the template in a 20 ul reaction mix containing lightcycler faststart dna master hybprobe master mix roche diagnostics, mannheim, germany and 1 um, 250 nm and 5 mm of primers, probe and mgcl 2, respectively. Only template dna, primers, and additional mgcl 2 if necessary, have to be added. Taqman fast advanced master mix on the roche lightcycler 480. The modern instrument design, outstanding technical and software features, as well as advanced reagents and disposables of the lightcycler 480 system, exceed the. Lightcycler 480 genotyping software groups samples with similar melting profiles together and identifies each group as a genotype. The lightcycler faststart dna masterplus sybr green i can be used in conjunction with heatlabile uracildna glycosylase to prevent carryover contamination during pcr.
355 1129 954 380 1380 643 552 1178 1170 725 592 436 291 60 366 1461 868 836 583 860 622 1004 82 118 1185 949 11 1080 1451 1288 1244 446 1390 835 1027 1138 461 52 723